These 2 weeks have been very eventful and a great experience.
I have the basis to start finalizing this project and I will discuss these details below.
Additionally some unexpected and relatively catastrophic events occurred that I will also elaborate on.
The main conclusion is that surprisingly due to all obstacles headway is being made, much has been learned and this is one exciting process.

TRANSFECTION

Transfection is based on research from the following paper published in CELL “Visualizing Spatiotemporal Dynamics of Multicellular Cell-Cycle Progression”. Miyawaki and colleagues developed the Fluorescence Ubiquitination Cell Cycle Indicator (FUCCI), a fluorescent protein (FP)-based sensor that employs a red (RFP) and a green (GFP) fluorescent protein fused to different regulators of the cell cycle: Cdt1 and geminin.

These two constructs, Cdt1 and geminin, are ubiquitinated by specific ubiquitin E3
ligases targeting them to the proteasome for degradation. The temporal regulation of the
activity of these E3 ligases results in the biphasic cycling of geminin and Cdt1 through the cell cycle.

In the G1 phase of the cell cycle, geminin is broken down and only Cdt1 tagged
with RFP may be visualized, thus identifying cells in the G1 phase with red fluorescent nuclei.
In the S, G2, and M phases, however, Cdt1 is degraded and only geminin tagged with GFP
remains, thus identifying cells in these phases with green fluorescent nuclei. During the G1/S
transition, as Cdt1 levels decrease and geminin levels increase, both proteins are present in
the cells, allowing GFP and RFP fluorescence to be observed—when green and red images
are overlaid, the cells appear with yellow fluorescent nuclei. This dynamic color change from
red-to-yellow-to-green represents the progression through cell cycle and division.”

Transfection is through an insect virus, baculovirus. I am following thisprotocol from Invitrogen.

IMAGING CODE

I have a working prototype in Ofx blob detection based on color.

I am exploring oscillations by averaging color intensity per channel.
Code is on GitHub

IMAGING HARDWARE

I am working on a physical prototype for imaging cells ie variants of how to image the cells.
I have a microscope and objectives

and have done some tests

However this doesn’t solve the issue of actually incubating the cells over a long period time.
To maintain PH levels in the media a specific atmospheric mixture of O2 and CO2 is required in a 37C incubation environment.
A prototype of what that might look like is this.

Peltier junctions to heat the microscope stage predictably to 37C and 2 tubes bringing in the specific environment of 5% CO2 to the dish.
The top is modified to let the objective into the media. The objective is a water immersion objective that can be dipped into the media. The focusing distance is approx 2-3mm for 40x.
The media will have to be replaced with a buffering media such as HEPES (4-(2-hydroxyethyl)-1-piperazineethanesulfonic acid ) to maintain PH levels.

Alternate variants

I have also been in touch with Ben founder of BIOBUS, a great organization for promoting social change through science, literally a bus full of lab grade equipment going around local schools and exposing kids to the magic of life through microscopy.
He has been awesome and has given me objectives for the fluorescence microscope in addition to suggesting an alternative solution.
Specifically access to a lumascope – a pretty cool device that works by inverting the logic of microscopy and incubation by creating a microscope that fits inside an incubator. Pretty cool!
Unfortunately the microscope has only one set of filters capable of only working with a GFP wavelength, which means I would not be able to capture the G2 stage of my cells.
Generally this is how fluorescence microscope work, and I would need to cycle through different set of filters to capture different wavelength fluorescence – mainly RED and GREEN

I would need the following wavelengths.

This will only be an option if all else fails but a good fail back. Oscillations are still possible with a single color channel.

The best thing that happened however is contact with a PHD candidate at Hunter who actually does exactly the type of microscopy and cell imaging as part of his research as what I would need.
Many thanks to Martin Bravo for putting me in touch.
This is a very promising lead and we have a meeting scheduled to discuss the project and possible collaboration.
It is entirely possible that this will solve most of my issue by giving me access to a professional setup and a person who does this as an integral part of his dissertation.
Updates to follow once we have a meeting but if this works out, 90% of problems will be solved.

Bad news

My cell culture has suffered contamination and it is horrific. Complete and total decimation.

I did everything possible to maintain sterile/aseptic technique but some things are unavoidable.
Keeping cool and got to work to salvage most of the work I had done. Estimation is that this places me approx 2 weeks behind.

I cleaned hood, incubator and fridge and bleach every single culture/ toss to make sure the contamination is under control.

I treated all my media with 100x ANTI ANTI( I do wonder if those 2 ANTI’s don’t cancel each other out), an antibiotic and antimycotic.

I was extremely curious to identify the organism that had destroyed my entire cell line and might cost me my thesis.

Phenotypic ID is possible but I would have to wait to grow a sample on a plate of agar, but all this newly acquired knowledge gives me a far more powerful and interesting path – sequencing the organism’s DNA and and comparing the results against a preexisting database, in this case one managed by the NIH and publicly available. Open data is really great.

This is what one needs to DNA fingerprint, and a PCR machine to magnify specific sequences.

I extracted DNA from a sample I had saved from my contaminated cultures, and sent for sequencing.

A few days later I received the following sequence:

NNNNNNNNNNNNNNAGACTTTCACTAGATCAGACAGAGTTCGTCGTGTCTCCGGCGGGCGCGGGCCCGGGGCTGAGA
GCCCCCGGCGGCCATGAA
TGGCGGGCCCGCCGAAGCAAACTAAGGTACAGTAAACACGGTGGGTGGGAGGTTGGGCTCGCGAQG
AACCCTACACTCGGTAAT
GATCCTTCCGCACGTTCACCTACGGAGTCANNNNNNNNNNN

I ran a BLAST search( Basic Local Alignment Search Tool @ NCBI) on this sequence.
The program compares nucleotide or protein sequences to sequence databases and calculates the statistical significance of matches.

Here he is
Aspergillus flavus strain NIOCC 109 18S ribosomal RNA gene, partial
sequence; internal transcribed spacer 1, 5.8S ribosomal
RNA gene, and internal transcribed spacer 2, complete sequence;
and 28S ribosomal RNA gene, partial sequence
Length=550

Aspergillus is a common mold in the environment, known specifically for producing aflatoxin a carcinogenic and acutely toxic compound. While for most people this type of mold doesn’t pose significant health risks, for immuno-repressed people this is a serious risk.
The spores are less than 2.5 microns in size, which explains how they passed through the HEPA hood filter and through the filters of the flasks.
The irony is that because of the aflatoxin the guy actually fluoresces green. Lab lols.

This was fun, but a detour.
So what now?

I have no more cells left and as far as thesis is concerned it would make sense to just give up and salvage the remains.

No way!!!

I have been busy the past week, and fortunately, asking around always yields results.
I was put in touch with the Phillips Lab at the Departments of Medicine, Cell Biology and Pharmacology at the NYU Cancer Institute.
Many thanks to Mark R. Philips, M.D. Professor of Medicine, Cell Biology & Pharmacology.
An email later and I am now in contact with the lab manager about arranging a dish of 3T3 cells.
Pretty awesome.
If all goes according to plan, upon receiving the cells I will transfect them and begin imaging this Friday – Sunday and have footage ready to analyze next week.

The past 2 weeks have been extremely busy in becoming a member and setting up space, equipment and disposables( dishes, strippetes, pipettes etc) at Genspace, ordering medium and reagents, learning proper aseptic technique and culturing and passing the 3t3 fibroblast cells.

Prep
Since I am working with tissue culture, an aseptic technique( avoiding cross-contamination) is very important although sterility is better but likely unachievable in a non specific environment.
Oliver, Ellen and Sung from Genspace have been extremely helpful in helping me re-arrange the lab to set up a separate space for tissue work. I am optimistic this will be sufficient to avoid contamination. This is currently on of the biggest risks that I have to contain.
A few approaches to minimize this risk undertaken.
We acquired a laminar flow hood made specifically for such experiments, courtesy of Amanda Parkes, which comes complete with a UV lamp. The necessity for this device is that the hood automatically filters air from the top and creates an air flow that blocks any contaminants from entering the workspace. The hood wasn’t functional at first but with some perseverance we managed to get it running.

The second step was acquiring the cells and medium. Cells are 3T3 cells, with the following protocol at ATCC and the medium is DMEM and Bovine Calf Serum mixed in 10%.
Trypsin which is necessary to eat away to proteins that stick 3T3 to surface and DMSO – Dimethylsulfoxide is necessary for cryogenic preservation to avoid ice formation in cells when frozen, was ordered as well.

Liquid Nitrogen and C02 was ordered for respectively for cryogenic preservation and incubation

Proper Technique and Cell Cycle Theory

I made a trip to Valhalla NY to New York Medical College where I spent the day shadowing Ellen Jorgensen PHD for proper cell tissue technique.
This is not complicated but requires some discipline and preplanning so I came out with the following tips.

Obviously wearing gloves and labcoat is mandatory
Everything that goes into the hood must be sprayed with 75% ethanol.
This includes all reagents,medium dishes, pipettes etc.
All work is done in a hood behind glass to avoid cross contamination.
Anything that comes out of the hood is again sprayed with ethanol.
All caps when screwed off must never be placed facing down, but always facing up.
Do not touch any edges on the throat of bottles, and don’t touch any of the tips against any surface.
One must preplan so that all components for your experiments are in the hood prior to starting.
One must avoid bringing in components during the process of working in the hood.
Work quickly and open only what is necessary.

Cell cycle lecture was given by Frank Traganos PHD on a one on one basis.
I was helped to understand the separation between DNA synthesis and Protein synthesis during each phase in the cell cycle, which is something very important for me specifically due to the nature of my experiment. It is important for this experiment to be able to synchronize the cells and the current available methods involve using drugs that inhibit pathways relating to aspect of the cells responsible for DNA synthesis, thereby arresting synthesis. However the cell continues to synthesize protein which can result in all sorts of problems. In a sense you are decoupling 2 very important processes within the cell.
The solution to synchronizing non-chemically but kinetically is through a technique called mitotic shakeoff.
When cells undergo mitosis, they lift of the surface, and it is possible to extract the cells by physically tapping on the vessel. Cells are captured in the medium and can be pippeted out and placed on ice to briefly arrest them.
Repeating the procedure leads to a 2% success rate from the entire colony, which is approx 2000 cells per cycle once 70% confluency is reached.
Very helpful and I will be making use of this technique once I transfect the cells to express fluorescent proteins during each cell cycle.

The more theoretical aspect of the lecture was taken up by molecular pathways and phosphorylation, cyclin dependent kineses during the Interphase – G1( gap 1) S1 (DNA synthesis) G2 (gap 2) , and Mitosis – Prophase, Prometaphase, Metaphase, Anaphase, Telophase.
This is pretty complicated stuff and while logically super fascinating at this point I am not targeting any of the pathways except in an abstract sense when dealing with the actual phases.

Pathway diagram of G1 S

Pathway diagram of G2 M

The interdependency and complexity of pathways is extremely interesting and useful especially when working with cyclins since specific proteins can be targeted to affect the cell in each cycle. I have not included this here, but the process of undergoing mitosis also contains multiple gates and checks in order to make sure everything is going correctly.

Another useful concept explained by Dr. Traganos is an inherent heterogeneity within cell lines, ie one single cell line is not to be treated as a singular entity, that there is much variability.
The growth of cells is deterministic but movement between stages is often stochastic due to cell componentry critical mass requirement between stages i.e the cell must make copies of everything prior to mitosis, but sometimes the copies are not distributed correctly or evenly, hence there appears to be an unknown mechanism that regulates this minimum viable amount.
This is important as it explains the asynchronous nature of the cell cycle .

Culture

Cells were taken out of cryogenic storage and placed in the medium.
Incubated at 37 C and 5% CO2.

Next step was to replace the medium after 1 day. After this the cells need to be passed every 3 days.
Passing is necessary to avoid excess confluency. As a general rule, 3T3 cells must not be allowed to exceed 80% confluency/density or else they undergo a change in growth. Every 3 days they must be trypsinised, which involves using Trypsin to eat away at their surface proteins and lift them into the substrate.
At that point they will be replated at a lower density and we will preserve a line cryogenically.

And after replacing the medium we observed the cells to make sure everything is ok and were placed back in the incubator.

Microscope view. The fibroblasts are looking healthy and beautiful.

Next steps are passing and trypsinising the cells on Monday, March 19th.

Have discovered a way to transfect the cells with the proper proteins for fluorescence per cell cycle using geminin and atc protein sensor mechanism via baculovirus (a type insect virus)
Will be using a system by Invitrogen called BacMam 2.0
I will start transfecting once I receive the necessary components to build and transfect plasmids corresponding to each cell cycle.

A few issues to resolve are

1. Capturing this in real time is going to require specific conditions and device.

Cells need to be incubated in the proper conditions such as 37C and 5% Co2 to maintain PH levels in order to capture real-time timelapse of 60-70H. This means that cells need to be in incubation during filming, a difficult task, however not impossible.
Secondly special fluorescent microscope is required to excite the fluorescents in this case GFP and RFP around 620 and 640, and then use filters to capture the reflected fluorescence. Excitation wavelength NM is different than emitter wavelength NM, which means that specific filters need to be cycled to capture this. I might have a lead to such a setup at NYU Medical Center and should find out on Tuesday if that is so.

2. CODE in OFX to do blob detection, blob tracking and event detection that will work with the cells when expressing color for each cell state.

These 2 last steps are critical for my thesis, specifically in translating micro cellular events(cell cycle) into easily observable macro events. Our bodies are undergoing multiple divisions daily and even when standing still our biological machinery is vibrating with activity.
Perhaps if this is used to trigger or affect a process, whether programmatic or kinetic it would be even more interesting. Something to consider as I am moving to the due date.